Okr synonym. 82 mg of calcium. Okr synonym

 
 82 mg of calciumOkr synonym  KR 3: Launch <new product/new version of the product> by <date>

Transferring your notes into the template creates another chance for you to take a look. This information should not be considered complete, up. The insights gained can then help teams prioritize better in the future. The objectives in the OKR refer to the bigger picture and the key results will tell you how to get there. “5% increase in page views” is a key result. 57 mg of magnesium. The following formula sums up what Objectives should express: [Verb] + [adjective phrase] + [noun] + [adverb phrase] For example: Significantly increase inbound sales leads for our software. Seed. That is the okra seed characteristics. All the contributions will add up to a total of 100 percent. The main goal of this workshop format is to ensure all teams and employees are working towards the same company goals and are aligned both horizontally and vertically. The dry mature okra seed is capable of growing. It refers to a product, service, or other tangible result of working on a project. Objective: Boost staff career development. Objective Key Result OKR concept with icons. Excel download. January 7, 2021 by trafoosinc. OKR). But, it is possible that KRs scored great and still fail at the. OKR objectives are limited in number, which constrains focus to core priorities. OKRs were invented at Intel Corporation. 5 Free OKR Templates to Download Today. The development of OKR is generally attributed to Andrew Grove who introduced the approach to Intel in the 1970s. Key Result: Action word + metric to measure + from + X to Y. The OKR process is also called the OKR methodology. member holonym: bendy tree, portia tree, seaside mahoe, thespesia populnea - pantropical tree of usually seacoasts sometimes cultivated as an ornamental for its rounded heart-shaped leaves and showy yellow and purple flowers; yields valuable pink to dark red close-grained wood and oil. ). okras) The annual plant, Abelmoschus esculentus, possibly of Ethiopian origin, grown for its edible pods; the pods of the plant. Check our Scrabble Word Finder, Wordle solver, Words With Friends cheat dictionary, and WordHub word solver to find words that contain okr. Our OKR template can also help you: Set clear expectations for business goals and success with key stakeholders. A term for plants similar to okra in terms of mucilaginous characteristics, especially when cooked. optokinetic 0. The template includes columns for tracking progress throughout the quarter as. 1 meaning of "thespesia", and other words that relate to it. Conceptual illustration of the words OKR, Objective Key Result. Then augment it with extra check-in milestones. Key Result: Increase implementation CSAT from 60% to 70%. The objectives and key results methodology is a framework used by individuals, teams, departments, and organizational leaders focused on setting ambitious and measurable objectives clearly and collaboratively. 7 (verb) in the sense of inhale. Learn how OKRs help drive focus, purpose, and alignment. View our free and editable Okr performance appraisal form templates for Excel or Google Sheets. Weekdone is an online OKR tool designed to help organizations set and achieve their objectives and key results. If you’re looking for some sample team OKRs, check out our department-wise OKR suggestions: Key Result 1: Achieve 20% increase in monthly sales revenue. OKRs are how you track progress, create alignment, and encourage engagement around measurable goals. They are also known by the popular name “Lady fingers”. OKR Leadership Program - Become an OKR Champion with Viva Goals . 요약. OKR is listed in the World's most authoritative dictionary of abbreviations and acronyms. Key Result: 90% of customers reach their engagement threshold within two weeks of going live. OKR Management & Strategy Execution Software; Weekly Progress Reporting Software;International Journal of Food Science and Nutrition 40 modified cost effective hypercholesterolemic rat model by feeding low cost butter incorporated rat feed pellets. OKR’s original concept came from Intel and spread to other Silicon Valley companies. Biasanya, perihal OKR dan KPI ini akan dinilai oleh manajemen di perusahaan kamu bekerja, seperti kepala departemen, manajer, atau HRD. 0 to 1. This is because the technical definition of a fruit is the product of the pods of a flowering plant that contains seeds. suggest new. Company OKR examples. Thus, an OKR could be “launch customer engagement initiatives,” and the relevant KPI could be “10%+ growth of engaged customer views per month. Please find 4 English and definitions related to the word Okra. Management by Objectives (MBOs) and Objective and Key Results (OKRs) are two popular goal-setting systems for high performance teams. In 1968, Andrew Grove co-founded Intel and — while CEO at Intel — he further developed MBO into the OKR framework as we know it today. OKR detailed presentation template. difficulty. Find more similar words at wordhippo. long green edible beaked pods of the okra plant n. driving ability. Your team can use it during the weekly check-ins to monitor the progress of the OKRs. Aligning to the product strategy. Written by James McAulay. OKRs enable organizations to track progress towards an. The origin of OKRs is rooted in the “Management By Objectives” system that was founded by consultant and. This is the example from our HR example video – get a complete breakdown of how this OKR came to life based on possible real world scenarios. There are also your weekly Plans. OKR. A brief history of OKR OKR has a long history that can be traced back to 1954 when Peter Drucker invented MBO or Management by Objectives. Download Our Free OKR Templates in Google Docs and Get Started with Your Goal Tracker. OKRs enable organizations to track progress towards an overarching. g. Stage 1. Increase Employee Net Promotor Score (eNPS) by 15%. Antonyms for okra. Reason #7: You demand personal OKRs from all team members. If you’ve been around the Lean-Agile or tech space for a while, it’s likely. The OKR acronym stands for Objectives and Key Results. Full list of synonyms for Okra is here. – Increase the quality of hire from 30% to 60%. Customize your slide look by changing its colors and adding. OKR Examples for better understanding: To enable you to better understand the concept, let’s discuss some examples from some organizations. HR OKR Example 1. Free or royalty-free photos and images. Synonyms for NORMAL: ordinary, usual, average, typical, routine, commonplace, common, standard; Antonyms of NORMAL: abnormal, unusual, extraordinary, strange, odd. Launch 5 new products or product features within the next year. Okra ( Abelmoschus esculentus) är en art i familjen malvaväxter. OKR is a management goal-setting system and. Contoh OKR divisi sales yaitu: Objective: Meningkatkan revenue hingga Rp5 miliar per tahun. Click the answer to find similar crossword clues . From Google, OKR spread to many other tech companies, like Twitter, LinkedIn, and Zynga. Go through the entire process and decide on the most optimal way the methodology works for you! Every OKR should reflect realistic priorities achievable in a three-month-cycle that are still challenging. the small green pods from a tropical plant eaten as a vegetable or used to make foods such as…. Aligning with other functions. Salah satu tujuan bisnis membuat OKR adalah untuk mengukur kinerja karyawan, karena bisnisbisa membuat membuat target yang cukup. fitness for driving. In 1974, John Doerr joined Intel and learned OKR during his time there. What are another words for Okra? Gumbo, okra plant, lady's-finger, Hibiscus esculentus. English (EN) Product; Use Cases. Find all the synonyms and alternative words for okr at Synonyms. The OKR method can help guide and focus your efforts, create more impact, build alignment, and bring all players behind the same vision. How do you say okr, learn the pronunciation of okr in PronounceHippo. Review the Weekdone onboarding options - our OKR experts are with you from day one. OKR’s original concept came from Intel and spread to other Silicon Valley companies. Best for: Gaining a clear understanding of how your OKRs are performing, identifying trends, and making data-informed decisions to drive your business forward. An OKR, or Objectives and Key Results, is a tool used in project management to help teams focus on specific goals and measure progress. Cultivated in tropical, subtropical, and warm temperate regions around the world, okra is used in the. Dissatisfied Question ID : 424429728 Status : Answered Chosen Option : 2 Q. ‍. en. MBO goals focus on the “what”; OKRs connect the “what” AND the “how. Also, another brief word of warning: Microsoft recently acquired Ally, and the company’s site appears to be in transition. 9 m) apart. OKR (Objectives and Key Results) is a robust framework used by businesses to plan, track and measure progress. wọ́n ń ká ilá tí kò gbó ― They were plucking unripe okra. OKR software refers to dedicated tools for setting, communicating, tracking, and measuring Objectives and Key Results within businesses. 646515. A. bring out. Translate okr Okar meaning in Marathi: okr Translate okr Okar meaning in Bengali: okr Translate okr Okar meaning in Telugu: okr Translate okr Okar meaning in Tamil: okr Translate okr. C. Use positive adjectives and verbs. T. This means that the okra is in the form of a seed. Being one of the world's leading OKR — Objectives and Key Results — software providers here at Weekdone, companies like yours often approach us with OKR questions:. Typically, an organization. okra meaning: 1. Please find 4 English and definitions related to the word Okra. OKR Meaning, Definition & Examples. Example no. Similar words for Okra Plant. okra: 1 n tall coarse annual of Old World tropics widely cultivated in southern United States and West Indies for its long mucilaginous green pods used as basis for soups and stews; sometimes placed in genus Hibiscus Synonyms: Abelmoschus esculentus , Hibiscus esculentus , gumbo , lady's-finger , okra plant Type of: herb , herbaceous plant a. Avoid words like “must” or “should”. The word okra is of West African origin and is cognate with ọkwurụ in the Igbo language spoken in Nigeria. This is how you would start moving towards your ambitious KPI target. You can think of an Objectives and Key Results template as setting up the foundation. Toxic Workplace Sign #3: The Toxic Boss. Other important beneficial nutrients in okra are calcium and potassium which help maintain good bone health and control muscle function. Below, you’ll find the most useful free, downloadable templates to help you plan OKRs. Corporate culture and mood are the second most important aspect for HR since it directly impacts employee retention and churn. . Google famously found the OKR framework to be an essential tool for pushing the envelope and achieving continual growth, along with other companies like Twitter and Uber. These are your big, aspirational goals. Key Result 2: Expand market share by 15% in target regions. “Given the success of OKR goal-setting, it’s evident why Adobe, Google, and Netflix all use it. A product tech company wants to launch a new product, at an organization level they can consider the below OKRs: Organization Objective : Launch a new version of our company product. The OKR Review usually takes place at the end of each cycle, in which all teams (including the leadership team) evaluate the final status of their OKRs. okn 0. OKR Meaning. Key results: – Hire 5 A-class engineers this quarter. List of Words Formed by Letters of okr: Words Created From okr: okr Definition at Wiktionary: Click Here: okr Definition at Merriam-Webster: Click Here: okr Definition at Dictionary: Click Here: okr Synonyms At Thesaurus: Click Here: okr Info At Wikipedia: Click Here: okr Search Results on Google: Click Here: okr Search Results on Bing: Click. OKRs are typically both less specific and more aspirational than SMART goals, and as such, they often encourage the journey toward cultural change or a breakthrough development. M. Immediate 3. . They describe what needs to change. Key result 3: Achieve 80% completion rate for the PDPs. In the presence of DNA, spn-A/Rad51 enhances the ATPase activity of okr/Rad54. %D À . OKRs are the objectives and key results of the OKR framework, which is a goal-setting tool to help teams, departments and organizations define their targets and determine the actionable steps they can take to achieve them. The definition of OKR is to set objectives for the future and measure those objectives with Key Results. Objective: Launch a new, redesigned landing page for your company. Pro tip: Key results are almost always defined. ”. Complete implementation of new career mentoring initiative. I often hear the argument that OKR software will help with alignment. 2. Key Results: Develop 1 detailed change management plan outlining. Key Result 1: Test the existing landing page to highlight the pain points suitable for a redesign. While most companies set goals, only 16% of knowledge workers say their company is effective at setting and communicating company goals. Seed. OKR is a simple yet powerful tool for startups to stay focused on what really matters while keeping the team aligned to maximize results and excel on execution. Learn more. Objective: Drastically increase team performance; Key result 1: Increase the OKR completion rate for team members from 60% to 70% Key result 2: Increase the participation on the weekly check-ins from 75% to 90% Key result 3: Increase the product teams velocity from 112 to 150 HR OKR Example 2. They bring a level of transparency: As we just said, OKRs are a form of communication. ”. The key word there is align. The Crossword Solver found 30 answers to "snow peas and okra", 4 letters crossword clue. And a powerful way to formulate goals, enabling organizations, teams, and individuals to set clear and measurable outcome-driven goals that encourage collaboration. Find all the synonyms and alternative words for okra at Synonyms. This paper analyzes gender gaps in the Colombian labor market, with a particular. Objective: Implement personal development program for all team members. Key Result: 90% of all customers live in 4 weeks. 200 Synonyms Words List. Use them in commercial designs under lifetime, perpetual & worldwide rights. OKR is an acronym for Objective and Key Results, a goal management framework used by leading silicon valley companies as well as growing startups to align and implement. A Portfolio strategic theme defined as in OKR format Writing Well-formed OKRsOKR Templates Get Started with OKRs by Using These Objectives and Key Results Templates. Reason #3: Your KRs are performance targets (KPIs) Reason #4: You turned measurable KRs into lower level Objectives. The default contribution is automatically assigned by Viva Goals to all the children equally. ; Other popular okra varieties include Red. What are synonyms for Okro?This is the example from our HR example video – get a complete breakdown of how this OKR came to life based on possible real world scenarios. Find Okr stock images in HD and millions of other royalty-free stock photos, 3D objects, illustrations and vectors in the Shutterstock collection. Managers can ensure that the personal OKR goals that are set by employees have a specific goal. 0. Schedule regular team/department presentations on OKRs progress, mid-term results, and potential bottlenecks to monitor overall progress and make adjustments. Goals. Find 8 different ways to say AND, along with antonyms, related words, and example sentences at Thesaurus. Tujuan dari dijadikannya OKR sebagai metode pengukuran kinerja oleh perusahaan adalah karena OKR memungkinkan perusahaan membuat target yang cukup ambisius, namun dapat terukur segala pelaksanaannya. An OKR scorecard is a system for initiating change within an organization. More about "OKR" definition & score of OKR; all words containing OKR; all words ending with OKR; synonyms of OKR; antonyms of OKR; anagrams of OKR; Matching Words By Number of Letters; 4 letter starting with OKR; 5 letter starting with OKR; Explore more words. Then translate those to your sub-departments (Recruitment, HR Operations, L&D, etc. The first growth stage of okra is the seed phase. The OKR meaning. bhindi. [KR] Ensure a response rate to employee requests of 100%. 1 – 3 clearly written Objectives. Here are ten critical OKR examples in quality control: 1. Schedule regular team/department presentations on OKRs progress, mid-term results, and potential bottlenecks to monitor overall progress and make adjustments. ; The short-duration variety refers to dwarf varieties that were created later, which have a short stature, mature quickly, and bear small fruits. It fosters alignment and engagement around ambitious, challenging goals and their quantifiable. 16 Team OKR Examples. Its green pods can be harvested as early as 55 to 65 days upon seeding. It is used by organizations, teams, and individuals to set challenging goals with measurable results. Enter the length or pattern for better results. Use the following formula to write OKRs: OKR = Objective + 3 to 5 Key Results. Key Result: Identify 20 new content ideas and topics by 01/31. I had such clarity which I desperately needed even after the first couple chapters. OKR stands for Objectives and Key Results, which refers to a framework that provides an effective way to increase team productivity and achieve long-term goals. An OKR is a popular management strategy that defines objectives and tracks results. 573645. OKR example. driving characteristics. Summary. OKRs must promise clear business value — otherwise, there’s no reason to expend resources doing them. Synonyms for Okro in Free Thesaurus. Today organizations of any size and across all industries have embraced the. OKR simple presentation template. Key Result 3: Join five LinkedIn groups with at least 2,500 members each and leave comments on the 10 most popular discussions in each group. KR2: Maintain and exceed average weekly interactions (comments, shares) of 50. Microsoft Viva Goals is a goal-setting solution that aligns teams to your organization’s strategic priorities to drive results and create a culture of engaged employees focused on achieving common goals. Key result 2: Improve customer satisfaction score by 5%. OKRI conducts 10 live sessions, one session every week. OKRs can also help teams identify metrics to evaluate their progress toward a goal. Google OKR Grading Scale. Q. idioms. %3 «ÞMýJÿíWõÿÿõKTEÆ© ôb Ž±ëNã ‡¾ ¨¨ìBá!fZÛð]¥šÿgërjCåÇ¥ ƒÄ(®D[+§MÁ!•ª 4€ ÓxÓ ’Ø-ýÒ ñôCrÕú‡”ŽÿtÔábÿKÕ «ö â îM{w­ðCHnA "0& QOª s {{z k_ijÿ¹“¨5{€X ƒ9qQ€‹OòÁ]ËÖJ>ÎB 0 qd. Add example to software. ofmri. Working with OKRs often means a shift in the way people work, so it requires executive buy-in and it helps to incorporate some principles of change management and project management to make the rollout successful. Okra har mere end én betydning, afhængigt af sammenhængen. okra ( countable and uncountable; pl. A successful OKR presentation can help leadership and teams communicate internally and turn ideas into results. Here are some good OKR examples for a variety of different roles within an organization: CEO OKR Example. The value of a well stated OKR is identifying in very clear language exactly what outcome is desired (objective) and attach to it a quantifiable target (key result) typically within the next 30 – 90 days. In 1974, John Doerr joined Intel and learned OKR during his time there. While the KR belongs to the whole team, the owner is responsible for tracking the team’s progress on it. The basic requirements on an OKR template include: Owner. • Key Result 1: All team managers (10 total) attend Weekdone Theory and Usage training (free) • Key Result 2: Each team (5 total) set at least 1 good Team OKR. The OKR methodology involves utilizing two distinct elements to establish and monitor ambitious goals: objectives and key results. To increase employee engagement in goal setting and help your teams set and achieve ambitious. KR3: Expand the audience base from 5,00 to 8,00 in the quarter. While crafting, there are a few things you should keep in mind that help you create healthy, precise and well-written OKRs. Some objectives (e. ). A Key Result is the practical bit – the measurable steps you take to achieve your objective. If you started your seeds indoors, handle the seedlings very carefully and plant them 1 foot (0. Clearer communication OKRs create a clear and concise view of the company and team-wide goals and priorities. After you configure the connection, the next step is to link OKRs to GitHub repositories. Synonym: Hibiscus esculentus L. Challenging: The puzzle is challenging. OKR is an acronym for objectives and key results. This goal-setting methodology allows your team to set and track measurable goals, following this simple formula: Instead of starting from scratch each business quarter, you can just copy the template and fill in predefined fields for each objective. Okra boasts an impressive nutrient profile. Additionally, many of the synonyms include important context markers that aid language learners in the proper usage of those terms. The Crossword Solver found 30 answers to "Alternative name for okra (5)", 5 letters crossword clue. 3 cm). The World Bank Open Knowledge Repository (OKR) is The World Bank’s official open access repository for its research outputs and knowledge products. Similarly, OKR owners can control the viewers or editors on an OKR or. An OKR has three parts:review cycles. Connecting musicians with new performance opportunities. The user activation stage is the process of converting a new user into an active and engaged user of a product. Cowardly 2. okra, gumbo, okra plant, lady's-finger, Abelmoschus esculentus, Hibiscus esculentus noun. Setting only aspirational or operational goals — strike a balance between both types of objective. A. Whether you’re tracking performance or growth goals, follow OKRs closely and monitor progress with this Excel spreadsheet template. The OKR grading method utilizes a numerical scale of 0. 6 synonyms for okra: Abelmoschus esculentus, Hibiscus esculentus, lady's-finger, okra plant, gumbo, gumbo. Reason #6: Everything you do is an OKR. 6 synonyms for okra: Abelmoschus esculentus, Hibiscus esculentus, lady's-finger, okra plant, gumbo, gumbo. Key. First and foremost is that a BHAG is a long-term goal that changes the very essence of a team’s existence. 1: Outcome-based OKR. Aligning with other functions. Top 10 similar words or synonyms for okr. “In an interview with Harvard Business Review, John Doerr says there are five key OKR benefits. 3 m) apart in rows 3 feet (0. Along with fiber, these likely contribute to the antidiabetic properties of okra. Let’s look at an example. Definition: noun. 1: Outcome-based OKR. Align OKRs in Viva Goals. Good source of folate (B9) Another. Okra also provides some iron, niacin, phosphorus, and copper. com, the largest free online thesaurus, antonyms, definitions and translations resource on the web. Incorporating OKRs and dashboards across key meetings and activities helps build a healthy OKR program. Achieve a 20% increase in monthly sales revenue by the end of the quarter. The agreed upon time the OKRs are written fo (e. 1. This is where all OKR Owners and leadership come together to coordinate their OKR drafts. Helpful template for OKR presentations: OKR PowerPoint Template by. 1. Definition of synonym noun in Oxford Advanced Learner's Dictionary. Download OKR Tracking Template - Excel. PowerPoint download. For now (but not for long), just assume that a Goal or Sub-Goal in Asana is a synonym for. Making steady progress towards stretch goals is the aim here. Den omogna frukten äts rå eller kokad. as a food easy of digestion may well be admitted likewise the young Ocra an agreeable Food as well for the species as individual, dressed variously according to pleasure. Using OKR software can eliminate the technical bottlenecks caused by managing OKRs with spreadsheets or general-purpose HR tools. The OKR (Objectives and Key Results) framework is a goal-setting and strategy execution system. the small green pods from a tropical plant eaten as a vegetable or used to make foods such as…. Key result 2: Create a program for 100% of team members of the PDP. The simple OKR rhythm of check-ins and reviews also makes the goal-setting process faster and easier, drastically reducing the time and resources spent on the setting, reviewing, and adjustment of goals. Objective: Increase net sales to $2 million from $1. MLA. The KR, then, stands for Key Results. Objective: Make recruiting great. Enter your first objective. 2. 3. 9 m) apart. ‍. OKR (Objectives and Key Results) is two things: A goal management framework that helps organizations implement and execute their strategy. goals and be definite and meaningful. kr3. 30686: AGAGAAAGCTTTATA GCTTACAAGGTATACATAACTTT GACATTAAAA AATGTTATGTATACCTTGTAAGC TTTTTTGTAAGTATT: 100: TU (transcription unit) Source ID Genes Start End Strand Accuracy; Conserve operons. All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. A brief history of OKR OKR has a long history that can be traced back to 1954 when Peter Drucker invented MBO or Management by Objectives. Key Results are the measurable outcomes that show you the progress you’ve made towards accomplishing your Objectives. draw out. : Hibiscus abelmoschus L. Implement new bonus structure for top five performers each quarter. Summary. Key result 2: Expenses below $1. Objective: Improve salary competitiveness. Okra is a versatile crop with multiple uses of its leaves, buds, flowers, and pods. They improve employee engagement. It’s very hardy plant that can tolerate dry soil best but is more accustomed to moist soil. For example, one of your digital marketing OKRs may be to improve social media engagement and traffic. Objective, bisa dibilang sebagai target utama suatu. 3 m) apart in rows 3 feet (0. Some objectives (e. For each objective, there are typically between two to five key results [2]. cascading and linking Objectives and Key Results (OKRs) up, down, and. ladies' fingers. The OKR process sets goals and aligns efforts throughout a company. OKRs (“objectives and key results”) provide a goal-setting framework to keep your workforce’s efforts and energy aligned towards business priorities. Enter a Crossword Clue. com, the largest free online thesaurus, antonyms, definitions and translations resource on the web. Win the World Cup. 560609. They are responsible for maintaining a clean and healthy facility by completing various tasks. They do this through continuous performance measurement against predefined goals and objectives at regular intervals. Noun [ edit] The edible immature mucilaginous seed pod ( properly, capsule) of the Abelmoschus esculentus . draw out. Add your company's name at the top of the template. For organizations, alignment is about ensuring that everyone is working toward the same end goal. Company OKR Template by ClickUp. Example no. OKR sales akan berhubungan dengan revenue perusahaan yang dihasilkan dari penjualan. Regularly. 2. [3] In various Bantu languages,. Rich in nutrients. While many recognize the power of Objectives and Key Results (OKRs) to foster trust based on transparency, not. OKRs (acronym for “Objectives and Key Results”) are a framework that companies use to define, align, and execute on the company’s most important outcomes. There are cases that the seeds are too young and there’s a. To avoid that, set the 90-day OKR cycle for everyone at first. OKRs are made up of two parts: Objectives are the ambitious goals that inspire and rally teams towards a common outcome. A task lives on a checklist; it may be independent, part of an overall project, or within the OKR process. Weekdone provides teams with the necessary structure in order to set and manage OKRs. Our OKR Template helps you define your objectives and desired outcomes for your project. ”. Objective: Scale and improve implementation and adoption process in order to accelerate time to value. Objective 1: Skyrocket team performance. Synonyms for OK: alright, good, fine, nice, delicious, satisfactory, all right, pleasant; Antonyms of OK: unsatisfactory, bad, disagreeable, poor, unacceptable. Soul Food may also refer to: . Freebies galore. This means that the okra is in the form of a seed. As well, those companies. 82 mg of calcium. Weekdone is an OKR software for goal-setting, tracking progress, outlining plans, and implementing a weekly reporting process. okr pronunciation - How to properly say okr . If you have 2 Objectives with 6 Key Results each, you’ll have 12 Key Results in total. ‍. David Ocumarez. When you create or edit an OKR, select Connect data source to auto-update progress. “Create 5 web pages” is work. okra is actually a fruit and not a vegetable. Key Results. The mucilage also has other medicinal applications when used as a plasma replacement or blood volume expander.